Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15083A10
Clone ID IST15083A10
Vector VICTR80
Project tigm

Sequence tag IST15083A10HMR1
Sequence
NNCAAGCAGTTCCTGGTTCCGCTGGATGTCTCTACAACTCTCATAAAATATCTGCCCTTGGTGCTGCACGGCCAGCAGGT
TCTGCTCCTTGGGGAACCGAGCACAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13112538..13112643 106
NO GENE  


Sequence tag IST15083A10BBF1
Sequence
GTGTGGTACGGAAATGGCTATGAGAAGTTCCTGGGCGTTCCCATGAACCTCCGTGTCACTGAGCAAGGAGGCCAGCAGCT
GTCTGAGTCCTCTGAAGGTGAGTCTGCCCAGAGAGAATCTACTAGAACGCTTACTGGGTTCCCTAACGTCCAACTAAGAT
GCCAGAGACCCTGGAGAGGTGGATTGGCGCCATCTTTTTTTCTACAGCGTCTTTTTCTAAGGTTATCCATCTTTTCCCCC
TTCCCATTCTTGGGAATAAAAGACAAAGAACGCATGCCAGCATATTGTGGGCTAGTGAGTTTGATCCACTCCTGCTCANG
CNNGCTCTCTCAAATGATGGGCTGCAGCAACTTAGTGAGGTGGAAAATCAATTTANTGATTGAAACCNGCATAAAAGGAA
AAAAAGAAAGAN
Sequence Type genomic DNA
Unitrap ID UNI34029

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13112128..13112538 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042414 (Prdm14) NP_001074678 PR domain containing 14 Gene [Source:MGI (curated);Acc:Prdm14-001]

 
Come back to gene ENSMUSG00000042414


For any suggestions or comments, please send an email to unitrap@crg.es