Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0618
Clone ID XR0618
Vector pGT0lxf
Project sanger

Sequence tag XR0618
Sequence
CTTTACCTTCTTTCATATCTCTCGAGCTTTTTTGTTTCGATCTCTCTGATTCTTTATTTCTTCTTTTGTCCATGGTGAAA
CTGATTCATGCAGACCCAAAGCTTTTGCTTTGT
Sequence Type mRNA
Unitrap ID UNI2993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79239092..79239149 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es