Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14846D6
Clone ID IST14846D6
Vector VICTR76
Project tigm

Sequence tag IST14846D6HMR1
Sequence
TCTCTCTCTCTTTCTTTCTTTCTTTCTTTCTTTCT
Sequence Type genomic DNA
Unitrap ID UNI6743 UNI30984 UNI31073 UNI31079 UNI31804 UNI32182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3277600..3277634 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3540107..3540141 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000766 (Oprm1) NM_001039652 opioid receptor, mu 1 Gene [Source:MGI (curated);Acc:Oprm1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4535962..4535996 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3275777..3275811 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020671 (Rab10) NM_016676 RAB10, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105066]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3859657..3859691 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8631346..8631380 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3184862..3184896 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3116406..3116440 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3277777..3277811 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 7506120..7506154 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057440 (Mpp7) NP_001074756 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) Gene [Source:MGI Symbol;Acc:MGI:1922989]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3900711..3900745 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001750 (Tcirg1) NP_001129563 T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 Gene [Source:MGI Symbol;Acc:MGI:1350931]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3518594..3518628 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3156513..3156547 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 7231490..7231524 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3221312..3221346 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3774651..3774685 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3163448..3163482 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3078098..3078132 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4313191..4313225 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 830960..830994 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161895: 186684..186718 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 406639..406673 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161904: 98840..98874 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161906: 25843..25877 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 798463..798497 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161926: 101447..101481 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161937: 904418..904452 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165795: 198866..198900 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 6047..6081 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079803 (AC125149.4-206) A530032D15Rik protein [Source:UniProtKB/TrEMBL;Acc:Q52KL8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166311: 84586..84620 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166314: 73918..73952 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166326: 158191..158225 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166346: 1286..1320 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166349: 590075..590109 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166364: 167766..167800 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166368: 288629..288663 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166408: 409324..409358 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166421: 491235..491269 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166446: 22475..22509 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5412587..5412621 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 1896139..1896173 35
NO GENE  


Sequence tag IST14846D6HMF1
Sequence
TTGTGGGTGGCAGAATAAGTGAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCAGGCANANAGGACCT
CTCTGAGTTTGAGGCTACCAAAGCCTACAAAGCAAGTTCCAGGCAGGGATGCCAGGGATACACTGAGAGAAACCCTATCT
TGGGGCAAAAGAAAACAAAANCANAAAAGGTTCTGGCTTTTATTTTCANACATATGATTCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000079803


For any suggestions or comments, please send an email to unitrap@crg.es