Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14742F3
Clone ID IST14742F3
Vector VICTR76
Project tigm

Sequence tag IST14742F3HMR1
Sequence
GGGTNNNAGTCTTTANATATATTTTTTACTTCCAGAAAGTCTTAACAAAGCTATATTCACTCCCTCACCTCTATATCTTT
GTCAGTAATACCAGCTCAAATGACAGAACCTGGAACCTAGAGTTTATCANCTGACATAGTCTACTTTAAATTGGACATTT
GCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI35599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44934330..44934495 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035649 (Zcchc7) NM_177027 zinc finger, CCHC domain containing 7 Gene [Source:MGI (curated);Acc:Zcchc7-003]


Sequence tag IST14742F3HMF1
Sequence
GCTACCAAATGAACTATTTATGAAAGCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035649


For any suggestions or comments, please send an email to unitrap@crg.es