Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST466165
Clone ID OST466165
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST466165
Sequence
GACTGAGGTTAAGTGGTAAGCAATGGCCAAATTTAGAAACTCTGGATGATGACATAGCTACAGTGTTTGATGAAATTCTA
GTCCGGGATATTCTGGAGCCAGGGAAAGCACCATATTTTGAAAATCAAAGCCCATCAACAACTTCACAACAAAAAACAAC
GAAGGAAAAAGAAGTCCACACNANAAGAACCCATACCTTCTAAGACATATCAGAAGCAGTCATCTTCTGGGACCATGCAC
ACCCCTTCCTTTGACGATAAGCAGAAAGAAATACTTTTTCAGCTAAGAAGCCTTGAAGCTCTGGAGAANATGATTGACAA
GATTCGAAGAGCTATTGAAACTAAGCTCANGAGAAGACAGAAGCTCCAGCNAAGTAGAAGCAGTCAACTNCTGGGGAAGC
CAATCCAGCCCTAAGTACTAGGCCTGGCGAGAGGGACAAGCCACTGCCGCACATGGGGACAGAAGAGAGTGGAAGGAGCC
ATCGACCTG
Sequence Type mRNA
Unitrap ID UNI16132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11655530..11665100 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031509 (1700016D06Rik) NM_024271 RIKEN cDNA 1700016D06 gene Gene [Source:MGI Symbol;Acc:MGI:1923663]

 
Come back to gene ENSMUSG00000031509


For any suggestions or comments, please send an email to unitrap@crg.es