Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14148D3
Clone ID IST14148D3
Vector VICTR74
Project tigm

Sequence tag IST14148D3HMR1
Sequence
AANTNNCTNNTTAAATGTATCANATCTGTATCACTTTCCTTTGTGTTTCCAGAGATACGGGTAGTTGATTATTATCCTTT
TCTAGCCATTATGATTAATGAAAAGTGTTGCTAAATATTAAGACTAACCACTCTTAACTGAATGACTTCCCAGTCAGTGG
CTCCTCTCCACTGTGTGTCTACAAATGTTTTTTTCCCTCTTAAAGCGTCCTTGAGTCATTTTANTAAGACTGTTAGTGTC
CTAGCCTACACATCTTCATCACAGACAGGGAAGCTCANTANCCGAAGACACCGANTTCTGTN
Sequence Type genomic DNA
Unitrap ID UNI14706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32262698..32262988 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027663 (Zmat3) NM_009517 zinc finger matrin type 3 Gene [Source:MGI (curated);Acc:Zmat3-001]


Sequence tag IST14148D3BBF1
Sequence
AGACATTCAAAGAGCAAAGATGATTAGGGATATTGGAGGCAGGGTAATGAAATCATCTTTTTAAATAGATTAACTACTTA
NATAGAACGGACCATGTCATTCTGACCCTAACTTGTCATCCAGATTCTCTGTTANATCATAGAGAAAGGACAGGGCANGA
TATCAAAACATCTGGATATAGAAAATCAGCAATATACATAGAGAACCGAATCAGCATGCTCCCAAGACATGCCTGGGCTT
GTTTCTCACATGCTTACTCCCACCTGATGAAACCCCAGCATGCGTGGCCCCAGAATCATGCAGCAGTCCTGCAGAAACAA
NGCCCTCCTCCCAGCAGANGCACAAAAAGGCCTTATTTCNAAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32263029..32263392 352
 
EST/CDNA Est Name
  CX201039.1 - BY254048.1 - AI132403.1

 
Come back to gene CX201039.1 - BY254048.1 - AI132403.1


For any suggestions or comments, please send an email to unitrap@crg.es