Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11813A1
Clone ID IST11813A1
Vector VICTR76
Project tigm

Sequence tag IST11813A1BBF1
Sequence
AAGCTTAGATCCTCACTTTGAGGATTCACTTTTAGGAGATGGAGATCCTGAGTTTTTAAAGCCAGGAAGCTCATACAGAA
AACCAGGTGCCCAGCAGTGGTGGTGCATATCTTTAATCCAGCACTTGAAAGGCAGAGGCAAGTGGATCTCTTGACTTTGA
GGCCAGCTTCATCTACAAAGCAAGTTCTAGAACAGCTAGAGCTACNCANANAAACCCTGTCTCTAAACTGTTCCCTACCC
CACTCCCCAAAAAGAATGACTCGTTCTGTGAAAGCCANGAAAAGTTATTCCTACTGTTCACTCTACACTTTCTTATGCTG
TTCTCCTAANGCTGGGACATGGAGAACAGGTCATGGCCTGTGGCTTTGAAGAGCTCGTTCAGTGTANCACAGATAATCTC
ACTGGATGTNATNAGAAAAGTGGCATTTTCACTTTGAAAAAACANNTNNNATCNNAGGTGANGGTGAANNTTCAANGCNG
ATTGATGTATGACTGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11813A1HMF1
Sequence
AAGCTTAGATCCTCACTTTGAGGATTCACTTTTAGGAGATGGAGATCCTGAGTTTTTAAAGCCAGGAAGCTCATACAGAA
AACCAGGTGCCCAGCAGTGGTGGTGCATATCTTTAATCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI15928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134175868..134175989 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es