Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11592F9
Clone ID IST11592F9
Vector VICTR76
Project tigm

Sequence tag IST11592F9BBF1
Sequence
CAACCACATGGTGGCTCACAATCACCCATAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI17846 UNI35640

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 80219166..80219205 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 109814507..109814546 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100937121..100937160 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97766466..97766505 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9013723..9013762 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31589252..31589291 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041119 (Pde9a) NM_008804 phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36408122..36408161 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121542316..121542355 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121493155..121493194 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134940468..134940507 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147632034..147632073 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134853391..134853430 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62732903..62732942 40
NO GENE  


Sequence tag IST11592F9HMF1
Sequence
CAACCNCATGGTGGCTCACAATCCCCCATAATGAGATCNGANGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es