Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14809G7
Clone ID IST14809G7
Vector VICTR76
Project tigm

Sequence tag IST14809G7HMR1
Sequence
GGGAATCCGANTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI34410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5300354..5300408 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]

 
Come back to gene ENSMUSG00000039145


For any suggestions or comments, please send an email to unitrap@crg.es