Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12622B2
Clone ID IST12622B2
Vector VICTR76
Project tigm

Sequence tag IST12622B2BBF1
Sequence
TCCCTACGGATGGTTGTGAGCCACCATGTGGTCGCTGGAACTCGAACTCAGGACCTTCANAAGAACAGTCAAGTGCTCCT
ACCAGCTGANCCATCTCACCAGCTCAAATTAAAGAATTTTAAATGAAAAAGAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95027612..95027757 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]

 
Come back to gene ENSMUSG00000053192


For any suggestions or comments, please send an email to unitrap@crg.es