Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10493D7
Clone ID IST10493D7
Vector VICTR76
Project tigm

Sequence tag IST10493D7HMR1
Sequence
TTATAAACAAAACAAAAGGCTTACTTAAGACTTACTTGANTNTNNTTCAAGGAAATTTTAGCCCTTGAGGCTTTGCAATC
AAGAGTATGTGTGTATAAAACTCAACCAACCTGGGTTTTGTTTCCATTACAGCCCAGTATTCTCTGCCTCACTTTTATTT
ACCATTTTGTGCCAAGACTGGGAGAAACTGTGATAATNANGAAGGATTTGACAACATTTATAACATTCCCTACCGTGTGA
GTGACTTATTTTATACAAAACAGAGCANAGAGATTTCGAATTTCCATTTAAATGTCCACAGTTACAATACAGAAGTTGGA
GCTCAACTCTNNNTACTGATTTGCTTGTATATGTNNNTTCTGAANCANTTANNAAATTCNCANCTCNCGGGANGCNAAGG
CNNGCGGANTNNNGANTTCNANGCCNANCTGGTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10493D7BBF1
Sequence
ATAATAAACTAAACTTGTTTGCTTTGATCAACATGAAAACCAGTACTTCTTTTAGTAGAAGCTGGAGTCTTTAGATAAGA
TTTTTTTAAATTGCTATTCTATGTGGAGATTTTTGTGGTGACAGACTGAGACCCAACAGTGCTATCTAGATTCTTGAAAA
CAGTGAGATTTCAAGTCAAGTCCCTTATGACATGAAAGAATGCGAGGAATGCGAGGAATCAGGGAAGTAGGCCACGGTTT
AAAGTATTACACTGGCCAGAGAAAGCTTCTCAGGCAGTCTCTCTGAGCCCTGGAACCCAGCAGATCCCTCTCCCAGAATG
CTGCCNTCTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6063823..6064175 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST10493D7HMF1
Sequence
ATAATAAACTAAACTTGTTTGCTTTGATNAACATGAAAACCAGTACTTCTTTTANTAGAAGCTGGAGTCTTTAGATAAGA
TTTTTTTAAATTGCTATTCTATGTGGAGATTTTTGTGGTGACAGACTGAGACCCAACAGTGCTATCTANATTCTTGAAAA
CAGTGAGATTTNAAGTCAAGTCCCTTATGACATGAAANAATGCGAGGAATGCGAGGAATCANGGAANTAGGCCACGGTTT
AAAGTATTACACTGGA
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6063921..6064175 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es