Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10104A4
Clone ID IST10104A4
Vector VICTR76
Project tigm

Sequence tag IST10104A4HMR1
Sequence
NTCACCCAGTGCAGTAAGTAACTGAGACAGTTACTTACATAGGGATTCAAGATCCCCGAAGTCATCACTGGACTTAGTGT
TTGCTTATTTATACAGGGTTAGACATATCCCAGGCTGGTCTTGAACTTTTCAAGCTATCTGTAGTTGAGGATGACCCTGA
ACTTCTGATCTTCCTATTTCCACCTCCCCAGTAGTGGGATTACAGGTGTGTACCTGTTTTTCTTTTGTTTATTTTTGTCT
TGTGTTGGGGATGGAACCAAGGACCTTGTGTATGCTAGGCAAGCATTCAACCAACTGAGCTACATCCCTTGTCTTGTTGG
TTTGAAGATTATCTTTCTGATTTTCAGTGATTCTGTTTACAGTTACTATACTCACAGGGTTTTGAGTTTGTTANATACAT
AGATTAATATTTTTCACAATTTANGGGAAAGGTATCAGTTCTTAANTCTTTTNANGACNNTTTTAAAATGNTTTTCTTTT
ATACCNAAATTCNGTTCCCATNNNCNTANNNAT
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507790..108508289 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST10104A4HMF1
Sequence
CAGGAAGCCTCAAATCAACCTACACCATGACACACTTCCTCCAACAAGGCCATACCACCCAATAGTGCCACTCAATAAAA
CATGAATCTATGGGGCCAAACCTATTCAAACCACTAAATTCCACTCCCTGGCCCGTATAGGCTTATAGCCATAACACAAT
GCAAAATGCATTTAGTCCAACTTCACAAGTCTGTCTATTGAAGTGACAACAATGTTTAAAAGTTCAAAGTTCAAAATCTC
TTCTGAGATTCATGCAATCTCTTTACTGCAGTTCCCTATAAAATNAAAAAGCAGACAGCATATTTCAAAAGAATGGATAT
ACATTACCATTTCAAAAATATCAAGAGTTTGGAAATACTGGATCAAAACAAGACCNAAAACCTGCTGGGCAAACTCTCAA
CTCTGCATCTCCANCTGCATGTCCNATTCCTTTNAGCTTTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507329..108507774 436
 
EST/CDNA Est Name
  CF895920.1

 
Come back to gene CF895920.1


For any suggestions or comments, please send an email to unitrap@crg.es