Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15071F7
Clone ID IST15071F7
Vector VICTR80
Project tigm

Sequence tag IST15071F7BBF1
Sequence
AATAAACAAACAAATGAAATGAATAAATAAAAAAATAAAGTGGTTAAAAAATTAAATTGATTGTTTAAAAACTTACGGGC
AAACATGAGTTGAGATCCCCAGTGCCCAGTTCTAATTTGGGGTGCTGTTAAGCGCCTGCCTATAAGGCCCTCTCTGTGGG
GAGCCGCCCTCACATTCACCTTTGCAAGATGGCGCTGACATCCTGTGTTCTAAGTGGTAAACAAATAATCTGCGCATGTG
CCAAGGGTAGTTCTCCACCCCATGTGCTCTACCTTCCCCGTGACGACAACTCGGCCGATGGGCTGCAGCCAATCAGGGAG
TAATACATCCTANGCGGAGAATAATTCTCCTTAAAAAGGGACGGGGTTTCGCCNTTCNCTCTCTTGCTCTTGCGCTCTTG
CGCTCTGGCTCCTAAAGATGTAAGCNATAGAGCTCTTGCTCTCTTGNACTCTTGCTCCTGAANANGTAANCAATAANNCT
TTGCCGCAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30279255..30279744 470
NO GENE  


Sequence tag IST15071F7HMF2
Sequence
ATCCTTGCTCTTCTTTAACATCCCATCCCACCACAACTATCCACCTCACTAGCTCCCAAAGCCCCTACTTATCCCTGACT
CCCCCACCCACTCACCCGACCACGTGTTTATTGACTTTGTGCACCAGGCACTGAGATGGGCTGGACCTGGTGGCAGGAAG
CCAGAGAACCTGGGACTAGGCCAGAAGTTCCCAACTGTGAGGGGGAAGAGCTGGGGACAAGCTCCTCCCTGGATCCCTGT
GGATTTTGAAAAGATACTATTTTTATTATTATTGTGACAAAATGTTAAATGGATATTAAAGAGAATAAATCATGATTTCT
CTTCTTTGGGGTTCAGAGTAACTGAAGATTGTGGGAAGGGGATTTAGGCTTTGGGGAACAGGGACCTGCATGCCTCCAAG
CTGCNNTTCTGAATAGANNTNNCAAAGGTNNCAGAAAAAAAATGCNAN
Sequence Type genomic DNA
Unitrap ID UNI30001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69499729..69500173 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST15071F7HMR1
Sequence
NTNNNTTGACATCCCAAATGCTGTTCCCCCTACCANTCTCTCCCTCAAAGAGTTCCTCCCTCCCACTCCTCCCAAGTTTT
AATTTTAAGTTACCTGTAGTANTGTTTATAGTTCCTAATTTGCCTCTATGATCCTATATGTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI12321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30279743..30279882 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044477 (Zfand3) NM_148926 zinc finger, AN1-type domain 3 Gene [Source:MGI Symbol;Acc:MGI:1096572]

 
Come back to gene ENSMUSG00000044477


For any suggestions or comments, please send an email to unitrap@crg.es