Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST466092
Clone ID OST466092
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST466092
Sequence
ACTGAGCCTTTTACCTGGAAGCACAATGTCATCAGAATCCAGCAAAAAACGGAAACCCAAAGTGATCCGGAGTGATGGAA
CCCCAACTGAAGGGAAACGGAACCGGTCTGACACGGAGCAGGAAGGCAAATACTACANNGAGGAGGCTGAAGTTGACCTG
CGGGACCCTGGCAGAGACTATGAGTTGTACAAATACACATTGCCAGGAGCTACANANGCTTANGGNCGGAGATCNNGGAC
CTGAGGNGTNTGGNCNGNANNGACCATGTCCATTGAAATTGAAGAANGATGGANNCANAGNTGTNTNCACTTNATGACTN
TAAAGAAGTTTATCCNATTAACCCACATCAGATTAA
Sequence Type mRNA
Unitrap ID UNI16142

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4799792..4802176 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]

 
Come back to gene ENSMUSG00000034274


For any suggestions or comments, please send an email to unitrap@crg.es