Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14634A10
Clone ID IST14634A10
Vector VICTR74
Project tigm

Sequence tag IST14634A10BBF1
Sequence
CTGAGAATTTGGTAACTATTTAAAACAGATCCTGCAACTAAAGTAGCTAGCAACTCTTTGTCTAAATATTAGTCCTGTGG
CACAGATCAACTTCTAGGAGATATTGCTTCTCATCTGCTTCCATTTAACACAACCAGTTCTCTTCAGCTGTACGTTAAGT
TCTGACATAGCCTCTATTTTTTTGGAAAATAATTCAAATGCTCTTTTTTTCTGTGCATTCTTTTTTTTTTTTNCCNTTTT
TTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24300581..24300827 239
 
EST/CDNA Est Name
  AA108544.1 - CN694948.1


Sequence tag IST14634A10HMF1
Sequence
CTGAGAATTTGGTAACTATTTAAAACAGATCCTGCAACTAAAGTAGCTAGCAACTCTTTGTCTAAATATTAGTCCTGTGG
CACAGATCAACTTCTAGGAGATATTGCTTCTCATCTGCTTCCATTTAACACAACCAGTTCTCTTCAGCTGTACGTTAAGT
TCTGACATAGCCTCTATTTTTTTGGAAAATAATTCAAATGCTCTTTTTTTCTGTGCATTCTTTTTTTTTTTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24300581..24300812 232
NO GENE  


Sequence tag IST14634A10HMR1
Sequence
CTGAAACTGCNACCTTTGANTAATACCATGATAATATGATGCACTTACTCATGTGGTATCTTACAGGCTTTTGTGGTTTG
GTTTGCTGCTTCAAGCCAAGGATTCAAGCACTCGGCAGTCTTTATTGTTTCCATTTTCCTTTN
Sequence Type genomic DNA
Unitrap ID UNI10190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24300423..24300564 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031545 (Agpat6) NM_018743 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) Gene [Source:MGI Symbol;Acc:MGI:2142716]

 
Come back to gene ENSMUSG00000031545


For any suggestions or comments, please send an email to unitrap@crg.es