Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11227C9
Clone ID IST11227C9
Vector VICTR76
Project tigm

Sequence tag IST11227C9BBF1
Sequence
GAGGAGGTTGGGGGCAGAGAGGGGCTGGACTGAAGCCTTCGGGATCTGAGCAGATGCTGCCTTCCAGCACGCTGAGGGAT
CT
Sequence Type genomic DNA
Unitrap ID UNI22659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79989144..79989224 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]


Sequence tag IST11227C9HMF1
Sequence
GAGGAGGTTGGGGGCAGANAGGGGCTGGACTGAAGCCTTCGGGATCTGAGCAGATGCTGCCTTCCAGCACGCTGAGGGAT
CCCTGTCCCGCCTAGCTAGGACTCCACAGTGAGACCTGTCTCAAACCAAACAAGCAAATAAACAAACAAAACATACANCC
CANAGTCTGACCNNGTGCCCANACCTGTGGACCCTNNAACCNNTTTGGCTGGACTTCTGTCTCTGTCCAGCCNTTACGGG
GCNNTTTTCTGGGGAGGGTATGCATTCCNNNGAACTGGCCCCANGGAAAAGCTCTAGTGCATGTCTGACTGCANTNNNCN
NGCTGGAGAACCNNTGTGATAACCTCTCTCTGAACTGGCACTGACCCCTGTGCCTGACTTTGTCACATTTTCCTAAGANG
TTCCTTCTTNTGCANNATANNNAACCCCTTCAAGAAAAGATGGTTTGCCNTGGNNCCGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es