Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14856B6
Clone ID IST14856B6
Vector VICTR76
Project tigm

Sequence tag IST14856B6BBF1
Sequence
GTACCAAGCCCAGCACTGATCCATAAAAGTCCTGATTTCCTGCTCAGCACAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126804923..126804979 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]


Sequence tag IST14856B6HMF2
Sequence
TTCCTGTAGGTTGAAGATAATATCTGCTGGCATTTCTGTCTTTGAGGCTGGTAGAAGCTGGTTTTCTGCTAAATCTATAG
ATTCTAATCAAGAGGCTTTTTATCTACTATCACAAGCTGCTAGTTCTTACTTGGGGCAAGGAATGATTGCTCTAGAGGGC
CAGCACTTAGCCCAAGGTAATTAGCCTCTGGACCTGCAGCATTCCAATCTCCACAGTACTGAAATTCTTATTANCCAGTC
TCTGCAGACAGATTCCTGTCAAGTATTTTTATTTAGTTAGTATTAGAAATCTGTTAATTTCTCTGGCAAGACTCAGTATT
TTT
Sequence Type genomic DNA
Unitrap ID UNI9880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113736393..113736714 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003316 (Glg1) NM_009149 golgi apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:104967]


Sequence tag IST14856B6HMR1
Sequence
ACATTANNGGGTTTTTGTTTTCTGTTTTNGTAATTCNTTTTTATCTGACCTCCCTCCTCTTTCTGTGTTGATCTTTTAAT
ATCTAATCTTTAGATCTTGTCAGTTATAAATTTGAGAAATAAAGACTCGAGTCAAGACTTCAAACTTCTTTCAAACATAA
CATTTTATTTTCCTAGTTAGAATCTGAAGGGATCGTTTCACTGGCTGGTAANTCC
Sequence Type genomic DNA
Unitrap ID UNI23892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 83905441..83905654 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024248 (Cox7a2l) NM_009187 cytochrome c oxidase subunit VIIa polypeptide 2-like Gene [Source:MGI Symbol;Acc:MGI:106015]

 
Come back to gene ENSMUSG00000024248


For any suggestions or comments, please send an email to unitrap@crg.es