Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14231A2
Clone ID IST14231A2
Vector VICTR74
Project tigm

Sequence tag IST14231A2BBF1
Sequence
ACACCTCGGCTCTTCCAGTCTTCAAGCCTCAAGCCTGCATGACTCTTTGATCCCAAAGCTTTCCCCCAAGAAGGCTGAGA
GGTTGCTTCAGCAAGTTCCAACTGGAACTTAGCTGACTGCTTCTCCCCCTGCACGAGGACCCTATACCTGTCACTAGTGA
TCACTTCCCTTGCCTTCCCTCCTGCACTAGGCCCCTGTATCTCTGTCACTAGTGATCACTTCCCTTGGGCCCACAGGAAA
CAATCAAAAGACAACCAGAGGTAAACAGAGCTGCCCGTCTGCCANANGGGAAAGCGTGCTCTCAGANCCCCACAAAACTT
CTTCACCCTTGGTAGCACCACTACCTCCCATATCCCTGCCTGCACCTTTCTCCTGGTATCTTGGGCCAGGATGANGTCAA
GCTGATGGGCACAGCAAGTTCCCCAAAGTACAAAAATGTTCTCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116733394..116733838 437
 
EST/CDNA Est Name
  CA890489.1 - CA890519.1 - BB870071.1 - CK638702.1 - CD348626.1 - BU562111.1 - CN663728.1 - BY066411.1 - BY071647.1 - BB850627.1 - BB850823.1 - CA884734.1 - BY233666.1 - CA885244.1 - BB842928.1 - BY083400.1 - BB841739.1 - BY787505.1 - BY307298.1 - BY101780


Sequence tag IST14231A2HMR1
Sequence
GTGTGAAATGAGGANACCCCCTTGCTGTCTGTCCTCCAGAAGTCAGAGAGAAGGCTGACCGACTGAAAACTACTGCTGCA
CACCAAAAAAGTACTGTCCTAGTGGGAAGGGCTTCCCGTGCAGCAGTGTCACCCAACCCATACACAAACCCTTTGTACCT
GTACTGCCTCCTCCTTATAGATGAGGAGAGTGTCACTTANGGTAGCCTTGCATCAAAGCTTTGTAGCACTTGGAGGAGTT
TTATATCCAGATTTCATTAACTACTTGGAATTACTCAAGACTACTCTTTCCNNGNNNNNNNNNGTNNAGGANNNNNNNNN
GNGCTATTATTTTAAGTAAGCTTTNANTTTTANAGTANTTTCAGATTTATAGAAAAGTTGCAGAGAGGGCACTAAAAGTT
CCCATAGATCCTGGAAACNNTTAATATTTTCCTCTCTCNTTNNCNGGCCNNNNNCTGAGGGAGTGN
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116732933..116733397 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es