Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12130H1
Clone ID IST12130H1
Vector VICTR76
Project tigm

Sequence tag IST12130H1BBF1
Sequence
ATATACACTCACATCTACTAGAACAAAGACTGGGTGCTTTGTTCAGTCNCAGGGGAATAAGAACGGCAGTGAAAGATCAA
AAAAGTTCTGCCTCACTGGAGAAGGAAACTGTTTATAGCTTGGATGAGTATTCTCCAAAGACCTATGTGTTAAAGGCCTG
TGGTGCTATTGGGAAATGGTGGCACCTTTAAGAGGTGAAGCTACCTGGGTGTTCTACCACGTACNNTTGNNNGTGTGCTC
TTGGGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84777871..84778124 242
NO GENE  


Sequence tag IST12130H1HMF1
Sequence
NNNNNNACTNNCNTNNNNNNNANCAAANACTGGGTGCTTTGTTCNNTCNCAGGGGAATAAAAACGGCNNTGAAAGATCAA
AAAAGTTCTGCCTCACTGGANAAGGAAACTGTTTATNNCTTGGATGANTATTCTCCANAGACCTANGTGTTAAAGGCCTG
TGGTGCTATTGGGAAATGGTGGCNCCTTTAANAGGTGAAGCTACCTGGGTGTTCTACCACGTACCATTGTNAGTGTGCTC
TTGGGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12130H1HMR1
Sequence
ATATCTAGTGTATATCTAGTAGATGTGAGTGTACATCTAGTGTATAACTAGTGTATATCTAGTAGATGTGAATGTATATC
TAGTGTATATCANATGACTTCTGAGTCCATGCAGCCTGCCATGACAAAATATCATAAACTAGGTAGTTTATTTTTTAAAG
ATTTTTTTCTTTTACAGTTATAGATGCTGAAAGTTCACAATCAAGACAGAAGCATGTCCAATGTCTGATGAAGGCCCAGT
GTCTGGTTCATANATGAATCCTCATGTCATCCTCATGTGGTAGAAAGGGCAGGGCAGCTCTGACCTATTGTATAAGGGCT
CTAATGTCCTTTGCAAGGGCTCCCTTTATGACCCAATCCCTTTCAAACATTCCCATGTCCTAATGCCATCTATCATATTG
ATCATATTGGTAATCTGGTTTCTACCTATGACTTCNNGANACNTTN
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84778121..84778565 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es