Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10614D3
Clone ID IST10614D3
Vector VICTR76
Project tigm

Sequence tag IST10614D3HMF1
Sequence
GTCTACACAGTGAGTTCCAGGACAGCCAAGGTTACACAGAGAAACCA

Sequence Type genomic DNA
Unitrap ID UNI9638 UNI25872 UNI33734 UNI34153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47864485..47864530 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025067 (D19Ertd652e) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D669]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38393922..38393967 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64430677..64430722 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4582319..4582364 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81601346..81601391 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022390 (Zc3h7b) NM_001081016 zinc finger CCCH type containing 7B Gene [Source:MGI Symbol;Acc:MGI:1328310]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 41061489..41061534 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78079003..78079048 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98879913..98879958 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570983..40571028 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032024 (9030425E11Rik) NM_133733 RIKEN cDNA 9030425E11 gene Gene [Source:MGI Symbol;Acc:MGI:1918816]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105578853..105578898 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34762125..34762170 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 52012915..52012960 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30944011..30944056 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92896785..92896830 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54970909..54970954 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 38962486..38962531 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39557791..39557836 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103576695..103576740 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95236440..95236485 44
NO GENE  

 
Come back to gene ENSMUSG00000032024


For any suggestions or comments, please send an email to unitrap@crg.es