Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST466009
Clone ID OST466009
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST466009
Sequence
ACTGAGGTTGCTGTTCTGGCTGAGGCCATCTATGGCCCTGGTAGTGTTTTCATTCAAGACAAAGTCCATTCCATCTTTAT
TTATTAGCTGAGCAAATTCAGCTAATAANTTTCAAGACCCAGATTCAAGCAATAAAACATTTCTCTGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78378346..78424880 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021065 (Fut8) NM_016893 fucosyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:1858901]

 
Come back to gene ENSMUSG00000021065


For any suggestions or comments, please send an email to unitrap@crg.es