Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14700F4
Clone ID IST14700F4
Vector VICTR76
Project tigm

Sequence tag IST14700F4BBF1
Sequence
AGACGGGGAAGGCCCCCCCAAGAGCGGGTGAACAGACAATTATGGAACGGGAAGGACGTGGGGGTCAAGATGGAGGGAAG
GGGAGCCGCCCAGGAACCCAGAGAAGGGGGACTGGATAAGAGTCGGGGTTGTCTCCCTTACTGCCCCCCCCATCGGAGTT
TTCACACAAAGACACAGAATTCCCATTTCCACGCCCTCCCCTGCCCCTCCCCCCACCGTGCAAACATGGCTTTGCAAAGA
GGTGCCCAGAGCTCTGTGGAACTCTTACAATGGCTGGCATGGGGTCTGGGACCCCAAAGAAATCTGTGTTTCCCTTCCCT
GCCCACCCCACCCTTCCCAGAATCTGGCCCCCTCCCCCACAAGNNCTGGTTCTGTANNCTANGGGTTCTGGCCTTCCCCC
TGTTTTCTTCCCCCAACCCAAATCCTTATTACCCGTCCCAGGACTGGGGGTCTANGAGGGTCCNTAAGTCCCTGTCTCCA
TNNGGGANCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25288815..25289301 469
 
EST/CDNA Est Name
  AI413805.1 - BM114275.1 - BE196972.1 - AI851557.1 - BF456388.1 - BM117710.2 - AW050277.1


Sequence tag IST14700F4HMR1
Sequence
GATGTNTTGTTTAATCTGCAAAGGTATTTGAATACAAGTTAAACCGGTTCTCTTCCCATCTTTCACCTTACCCTGTGCGC
TCTAAAGCAAAGTCACCAAATAAAGGGCCATAAATTAGGTAAAGCCTGGGGGCGGGAATTCATTATTCATGTAGCAGTAN
TGTCATCTGANNNCCTTAATGAAATGTTTATATGANGN
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66558604..66558798 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es