Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14580F10
Clone ID IST14580F10
Vector VICTR74
Project tigm

Sequence tag IST14580F10HMF2
Sequence
TTATGAGGGTNNGNGNCNCCCNGNNNCNGNNGTNTGNGATGGTTGTGANCTGCCATGTGGGTANTCACTTCNCCNNCACC
TANCTGTCCCATGGCGAGCTTTGCACTCTACGGTCTCTTTTCTTTTCCCCTGGAAACTTAATTTTTTTAAATTCATTTTA
TTTTGGGGGCTAGGGAGCGTGACACGGAGCTCGCGTGTGANNTTNANGCCAACCTGCTGNAGTCAATTCACCTTATACCN
TGCNGGCTCCAGGGGTCNGGCTCANGTTGGCCGCNANCGCNTTTAGCCGCTGAGTCATCTCNNNNNNNCNCTCNTTGTAN
ACTTGAGACANGNTCNNNGCACGTANCANGGTGGNAACTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14580F10BBF3
Sequence
CTGCAACCTCTCCCAAAATCTTGATCACANTNNNACAGACTTCTAANNGNCAGCAGCTGAAATCTCAAGGCCAGAGTCAG
CAGCGTCCGTAGCCCCAACCCCGTCAGCTCTGAGGTCTCTCATCTTAATTAAATTCCTGGTTTCTAGACCCACCATACAC
AACCTGTGAGACACTCCACTTCAAACTCTGGGCCCTTAGATCCCAACAGCAGTTGCCCTCGTGCACTAGTCTGTCCTGCA
AACTCTCTGGTAATAGCTCCTACAGCTGCCAACAGGCATTACCTTGGGCCCTCTCCACACCAATACCAAGACTCCAACAC
AGCCCCAAAGANCTG
Sequence Type genomic DNA
Unitrap ID UNI35650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28092399..28092732 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST14580F10HMR1
Sequence
NACAAACATGTTTAGAGGCAAAANNCNNANTGCANAAAATAATAAAACGAATGGGCCANCTATCATTGAATCANACATCG
TTGCANAAAAGGGGCANCGAAAAGATTTTAAGATCCNGAGGTTGTGGANATCGNCNNGCACAAGGTCAAGTCANCTGCCN
NAATCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es