Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12161D4
Clone ID IST12161D4
Vector VICTR76
Project tigm

Sequence tag IST12161D4BBR1
Sequence
TCCGAAGGTCCANAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCATAACAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI7802 UNI9754 UNI30629 UNI31200 UNI33691 UNI35253 UNI35254

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 89592494..89592558 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 122227926..122227990 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034613 (Ppm1h) NP_001103688 protein phosphatase 1H (PP2C domain containing) Gene [Source:MGI Symbol;Acc:MGI:2442087]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32517619..32517683 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020272 (Stk10) NM_009288 serine/threonine kinase 10 Gene [Source:MGI (curated);Acc:Stk10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52985725..52985789 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035181 (Heatr5a) NM_177171 HEAT repeat containing 5A Gene [Source:MGI Symbol;Acc:MGI:2444133]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73376069..73376133 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42311786..42311850 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96248554..96248618 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26175469..26175533 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037098 (Rab11fip3) RAB11 family interacting protein 3 (class II) Gene [Source:MGI (curated);Acc:Rab11fip3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32796652..32796716 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 88846444..88846508 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142339949..142340013 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107535568..107535632 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028613 (Lrp8) NP_444303 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor Gene [Source:MGI (curated);Acc:Lrp8-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 141171262..141171326 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036555 (Iqce) NM_028833 IQ motif containing E Gene [Source:MGI (curated);Acc:Iqce-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72736112..72736176 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16983793..16983857 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 64829287..64829351 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109866110..109866174 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71521021..71521085 63
NO GENE  

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es