Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12397C5
Clone ID IST12397C5
Vector VICTR76
Project tigm

Sequence tag IST12397C5HMF1
Sequence
ATGGTGGCTCACAACCATCCGTAATGAGATCTGACGCCN
Sequence Type genomic DNA
Unitrap ID UNI2399 UNI7392 UNI9666 UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5931261..5931298 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 12350899..12350936 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7721800..7721837 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 12863391..12863428 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 13384254..13384291 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95255570..95255607 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021686 (Ap3b1) NM_009680 adaptor-related protein complex 3, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1333879]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4101751..4101788 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020657 (Rbj) NM_153082 DnaJ (Hsp40) homolog, subfamily C, member 27 Gene [Source:MGI Symbol;Acc:MGI:2443036]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 17138884..17138921 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13791028..13791065 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21782655..21782692 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021823 (Vcl) NM_009502 vinculin Gene [Source:MGI Symbol;Acc:MGI:98927]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36736676..36736713 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 49096457..49096494 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 13473403..13473440 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3361839..3361876 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23741954..23741991 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40717135..40717172 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 40851453..40851490 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12346698..12346735 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 9902935..9902972 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 55051796..55051833 38
NO GENE  


Sequence tag IST12397C5BBF1
Sequence
ATGGTGGCTCACAACCATCCGTAATGAGATCTGTCGA
Sequence Type genomic DNA
Unitrap ID UNI30754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45252629..45252664 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34735437..34735472 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87624136..87624171 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030528 (Blm) NM_001042527 Bloom syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1328362]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28367286..28367321 36
NO GENE  

 
Come back to gene ENSMUSG00000030528


For any suggestions or comments, please send an email to unitrap@crg.es