Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15012E8
Clone ID IST15012E8
Vector VICTR78
Project tigm

Sequence tag IST15012E8BBF1
Sequence
TTTAGAGTGAAGCAAGTCTCATCTTGACATCACTTCATATCCCCCAGACCTCATGCAGGGTCACTGGCCTCTGACAAAGA
GAGCAGAGGTGTCTTAATAGTGACCAGCACAACAAGAAAACTCCATAAATCTACAGTTGCACATACCTGTGACCTAGCAC
TGAGAAGTGAAGCTAGGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28918310..28918491 182
 
EST/CDNA Est Name
  AV026289.1


Sequence tag IST15012E8HMR1
Sequence
TAATGAGGGGCTGAGCCGGTGCTTCCAGGCAGTGGAAATGGAGCAGCACACACAAACTGCCTTCCTTTGTGGGATCTGAA
TGTGCCAGTANAAGAGAGAGATGTTGAATGACTGAGTAGCTAGTTGCTAATTTTTAAGTTACAAGTGCTTCAGAAAAGCA
GATAGCCACAGAGAACAAAGAGAGGCAGCTTTCCTTTGTAAATGGATACTGGTGTTCTTCTAGGATTTCATATGTAGTTT
GATCAGATTCATTCCACTACTTCCCCAACTCCTANANCTACCCCTACTCCCCTCCCTCTCCCCACAATTTCATGTCCTCT
TTCTGTTTTACAAATAACCNTCCAGTCAGGTTTGTGCTACCATATATTCTGAGTATGGGGCCNGCCTCTGGAGCNNTGTC
C
Sequence Type genomic DNA
Unitrap ID UNI30856

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28918489..28918888 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]

 
Come back to gene ENSMUSG00000026803


For any suggestions or comments, please send an email to unitrap@crg.es