Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15090E7
Clone ID IST15090E7
Vector VICTR80
Project tigm

Sequence tag IST15090E7HMR1
Sequence
NGCACACCCATGCTCCTCANGGACAGCACANNGTCACTTGGACAACTAANACAAAGGACCAGTGAGCAAATGCCTTCNTT
TCCACAGAGCTGTCTCCACTGCAACCTCCTGTTCAAACCCAGGGGGAACCGCTCAGTTTTAAGAACTGCTGCTTCAATTG
TCTTCTTCTCTGCTCACTCCTCAAAAGTCACCCANACTCGCCAATCTCCTTTATATCCTTCTACTTATTAACTTTTCAAA
AGAAGAGAGGAAAGCATACTTACATAAAATAGTTCTGCCTCACTTCCCTACTAACTTCAAGGATGAAAAGTAGGTTAGTT
AGCTGCCAAACTTCCTGCGTCTGTTTCCTTAACAGGTGCTCTGGGTCAAAATGTGAACCTAACCGTTTTTTGACCCATTA
CAACAGCAGGTTCATGTGGTCCAAATTCACTGAANTCNNAACAGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52786529..52786973 427
 
EST/CDNA Est Name
  BM941619.1


Sequence tag IST15090E7BBF1
Sequence
AGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCG
Sequence Type genomic DNA
Unitrap ID UNI4322 UNI22269 UNI29938 UNI33458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 130494..130558 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 110962..111026 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3821287..3821351 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10641340..10641404 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4625806..4625870 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4527798..4527862 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3483538..3483602 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3624913..3624977 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4610293..4610357 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020640 (Itsn2) NM_011365 intersectin 2 Gene [Source:MGI Symbol;Acc:MGI:1338049]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3376816..3376880 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7861827..7861891 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032000 (Birc3) NM_007464 baculoviral IAP repeat-containing 3 Gene [Source:MGI (curated);Acc:Birc3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8619130..8619194 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11102863..11102927 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3558050..3558114 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 6059470..6059534 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015112 (Slc25a13) NM_015829 solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13 Gene [Source:MGI Symbol;Acc:MGI:1354721]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3292603..3292667 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068566 (Myadm) NP_001087233 myeloid-associated differentiation marker Gene [Source:MGI Symbol;Acc:MGI:1355332]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 14402215..14402279 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5764711..5764775 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8566408..8566472 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6824832..6824896 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3198501..3198565 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4757376..4757440 65
NO GENE  

 
Come back to gene ENSMUSG00000068566


For any suggestions or comments, please send an email to unitrap@crg.es