Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14580H7
Clone ID IST14580H7
Vector VICTR74
Project tigm

Sequence tag IST14580H7HMF1
Sequence
ACAGGAGTGAACAACCAACCTAGGCAAGGTGCGGTTCGTCCTTTAAGGCAAGAAGAAAGAATAAAAATAGGACTGTGCTC
AGAGTCATTAACATCCCTGAAAGCTATGTTTTTCTGGAATGCTAAAAAAAAAATGCTGTNAATTTTGAAAACTGTTTATT
TTTANCTAATTAAAAATAAAANGGTNNGGGAAAAAANGTTNCTTTCTAAAAGGCNGGTTCTTCNTATTTCCCCCCCCNCN
AAACCNCNGGAAAAACTNANNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14580H7HMR1
Sequence
TGTAACCCTTTGATGCCTTTGGACAAGGAAACTAGAGAGGATCAGANNNNGCNNGNCNTTCTCTGAGCCCAAGGCCAGCC
TGAGGTTCGGACTGCCTAAAACCAACTCAGTCCAGCCTTAGCTCTGTGTTCACGGGACAACCCTTACCTTCTTGCCTCCT
AACTTTACAGATGTTTTAGTCTATTTTCTATAATACATGCTTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI4851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40506453..40506658 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]

 
Come back to gene ENSMUSG00000042032


For any suggestions or comments, please send an email to unitrap@crg.es