Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10293A11
Clone ID IST10293A11
Vector VICTR76
Project tigm

Sequence tag IST10293A11BBF2
Sequence
NNNCNTCTCCCGTNNNNNTANGTCTNGCNATNACNCNCTTNNNNNANNAACCNNNGAAAACACNACTGATACCTGNNTGG
NTNNNNNTNAANACAAAGAGCTGGGGTANGTGACTNNCTGTGACCTTNANAACCCTAGTTTAAAGGGACAGGAACAGTGC
TGGGTGGATAAAACAAAGANAGGACTTACGGNGTGAACAGGAATTTCCAGANNAAAGGCCATGTGTCCTTAAATGCTCCA
TCANGCNNNACAGGGCCTGCANANCTTCCNNTGGGCTGANTGACANANAGTANGTGAAACTGGCTTTGGCAGGNANGTTG
AGAGACAGGACGGGGCCGACAGACCATANGTAGTANGTGANNNAGTGGGAGGTGAGGAAGGGTGAACTGTTGGGAAAGCC
NGANAAGGCNNGGAGGTAGCTGCAGGGGGCCATGGNGTCAANGAAAGATCGGANAATACTCAAACAGGCANGAAGANGTA
GGGGTGAAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10293A11HMF1
Sequence
GATGCTCTCTGCCCACANAGAGGACTGGAAGCCAGTCCTTACGATAAACTCCATAATTTATGGCCTGCAGTATCTCTTCT
TGGTAAGTAGGGTTAGGCATTTGAAGCTGAGGGTTTGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI35661

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13621152..13621272 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005575 (Ube2m) NM_145578 ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) Gene [Source:MGI (curated);Acc:Ube2m-001]

 
Come back to gene ENSMUSG00000005575


For any suggestions or comments, please send an email to unitrap@crg.es