Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14654B2
Clone ID IST14654B2
Vector VICTR74
Project tigm

Sequence tag IST14654B2HMF1
Sequence
ATGCAAGATGCCCTTCAGTAGGGTGAGAAAAAAACGGATTAAACTCCTAATTAATGTGTATTATTAAGACAAATTGGCAA
AGCAGAACAATGCCACAAAATGACTATGCCTCTTTGGCTTTGAATTCCCAGTTTTAGTGAATTACATTCAAGACTATACC
ATTCAGAAGAGAAAAAACAATTGGTTTATGTATACTAACATTAAACTACTACAACGCACTTATTTGAAATATAGAACTCT
AAATTTCAAGCTATAAAGGGGCAGGAAGGCAGAGGACAAGATCAGTACTGTCAGAATACCTGCAGGAGGGTTACACGAAA
CAGTGCCGAGGTAAAGAAATGGCAGGGGAGGGAAGTCAAGTCATGTACTTGCTACAGTTTTTAAAAATAAGGGCACAGGA
CCNANAAATTTTGATATTTATAGAGAACAGAANATTTGGAATTTTTTGTTCTTGTTACTTNNNNGTTACTTCNAGTGTNN
GNNTGTTTCCTTGGTGTGNATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135084546..135085047 476
 
EST/CDNA Est Name
  BI248614.1 - BI647882.1 - BI734551.1 - DV660270.1 - BY704500.1 - CX231321.1 - BI685911.1 - CB056600.1 - BF580545.1 - BY705371.1 - BI687321.1 - CN698403.1 - BU504356.1 - BU522120.1 - BY703747.1 - CD563598.1 - CD560434.1 - BX514124.1 - AA204151.1 - CK622970


Sequence tag IST14654B2HMR1
Sequence
GCATGTGTTGGTTATGACTGTGGCTGCATTTATGTTAGTTTCAGGTTTTTGTGGATGAAATGTTGTTGAAGCAGGTTATG
ACTCTTTGN
Sequence Type genomic DNA
Unitrap ID UNI16684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135084462..135084549 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028165 (Cisd2) NM_025902 CDGSH iron sulfur domain 2 Gene [Source:MGI (curated);Acc:Cisd2-001]

 
Come back to gene ENSMUSG00000028165


For any suggestions or comments, please send an email to unitrap@crg.es