Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11513D6
Clone ID IST11513D6
Vector VICTR76
Project tigm

Sequence tag IST11513D6BBF1
Sequence
AGTTATGGAGAAACAGTCCCTACCTCCTGGAACTGTGGGAGAGCCAAATGGCTCACTGTAAAGCCAGGCCGCAGNNAATC
CTGTGAGGGACCGGAGTGAATGAGAAAGCATTCCTGGGATGTCTTTANCAAGTGAATTACCCCCTCCCCCCCCAGTTGAG
TTGTGGCTCTGCCTGCTGCTCCCATTGCCCTGTGCCCAGTAAGCCTGTCTTCTTCCTTAAAAACANAAAGGATTACTGCC
CAAATACNCGGTATTGATGGGGCANAAATAAAACAGGGCCCCAAAGCAACAAAACANAAACCNNTTCCGGGACTGTTTGT
AATTACTACTGTANACAGGTNATTAATGTANGTANATTGTGTACTGATAAAGTGAACTTAANACTGAATGACCCCCTTGG
ANTANATTATGTTTTCATTACTCTGTTAAATAGATTTCTTTACAAATTTCANCANTAAAAATTGNCAGTCTTTTACCTTT
CTGGTGTTTTCTANNNCN
Sequence Type genomic DNA
Unitrap ID UNI5198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114599554..114600046 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032435 (Dync1li1) NM_146229 dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]

 
Come back to gene ENSMUSG00000032435


For any suggestions or comments, please send an email to unitrap@crg.es