Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10459G3
Clone ID IST10459G3
Vector VICTR76
Project tigm

Sequence tag IST10459G3HMR1
Sequence
CAATCCTCANAGGAAAGGGAGGTCCCTGGCTCTTGTGATGCTTTGGAGTCTCTGTGCTGGANATGAAGCCCTGGACCTCA
CAGAAGTTGAACACTCTACCACTGGGCCACACCCAGCCCCTCTTCCCCTGCTTCTTTTGGGANACCGACTCCCAAGGTTA
AAAATTGGTTAGGGATGGTTATAGTTAGGCCGCAGGCCAAGAGGAGCGGGCTCTCGTTGTGTTCANTCACACNTCTGGCC
N
Sequence Type genomic DNA
Unitrap ID UNI15349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29485639..29485878 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]


Sequence tag IST10459G3BBF1
Sequence
GAAGTACGAAATATCAACATTTTTAAATACATGATATCTTANGGCAGAAGGGCCTTAAATAAGAATGAGCCTCATGTCCA
CTCTGCACTTCTCAAGTGTTCAGACTTANCAAGAACCCTGAAGTATCANAAAGCTTATANACGATTTCCTTCACACTATA
TGGCAGACCCACGGAAATGAAGAAATCTCACAGCTCACAGANCACTGACTTCACTGCACTGANGCANTCCTGGGGTCCCA
AGGAGAATGGATCTTCTTGTANCCCCTGCTCAGGCTCTCTCCACCTCTACCAGANAGGGATATATANGAACNGCTCNNCT
TCCTGCACACAGGCACTGGCTAATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29485291..29485639 323
NO GENE  

 
Come back to gene ENSMUSG00000039844


For any suggestions or comments, please send an email to unitrap@crg.es