Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14508D7
Clone ID IST14508D7
Vector VICTR74
Project tigm

Sequence tag IST14508D7HMR1
Sequence
CTTTGGCATCTTTATGTGTGTGCATGCATGCAGGGACACGTACAGGCATGTGCACCCACGAACGTACATATAAGCACAAA
GAATACCTTCATTAACACAGCTACTTAATTAGAATTANAANTAACATANCCTNANTACNGGGAAAGCTGATGCAGGAAAG
ACCCACATTCTAGGCTAGCTTAGTTATACAGCAAGATTTAGGCTAACTGGTGGCTTCGGTGAGACATGTCTCAGCTACTT
TCTGATCTCCCCAAAATTTGTTTTGAATGCTCAAACTGAATTGGGTTGAACCTAATGCCNGATACATTTGAAGTANTTGC
TGTACCATTAAATTACATCACAGCCNCTGAACCTCATTTATATTANCTTGTAATGTATGGAAATTTTAAAGAGGANGAGC
TNGAGAGATTGCTCAGTGGTTGANAGCTCNTGCTGCCCATGGAN
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72842659..72843101 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]

 
Come back to gene ENSMUSG00000034563


For any suggestions or comments, please send an email to unitrap@crg.es