Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13078G9
Clone ID IST13078G9
Vector VICTR76
Project tigm

Sequence tag IST13078G9HMF1
Sequence
GTAGTGGGCTCTTTAAGTCATTCCCCTCCCCCCACAACTCACTCCTAATATCGCTATAGACTACACAAACACTTGTTAAC
G
Sequence Type genomic DNA
Unitrap ID UNI35662

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120804596..120804675 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054484 (Tmem62) NM_175285 transmembrane protein 62 Gene [Source:MGI (curated);Acc:Tmem62-001]

 
Come back to gene ENSMUSG00000054484


For any suggestions or comments, please send an email to unitrap@crg.es