Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14748H11
Clone ID IST14748H11
Vector VICTR76
Project tigm

Sequence tag IST14748H11HMR1
Sequence
TTATAACGTCTGCTATAAAGTCTGAGCTGAGACATTTACTGTCTGTTTTAGTCNGCTGCCTTGCATTTCTGTTGTGGAAG
CGCAAAGGCATTTGTGGGCAGTGCTTTAGGGTTGTTTGTTTTTAAGTCAGGTTTCATCTTCCGTAACTTTCCTGCTTTTT
GTCTCCATTGTTGATTTCATAAAGGATCTTGAGATTGGATGTGCATCTGAAGGAGATTATAGTGTCTTGTTCTCANCCCT
ATAATTGCCATATAACTTTGCTGTGTTATTATATTGCTCATTTANGCCCGTTCCATAACAAAGCTNANNNAGGAATTTGA
NTCC
Sequence Type genomic DNA
Unitrap ID UNI10775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56036252..56036574 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044763 (Rg9mtd1) NM_029092 RNA (guanine-9-) methyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Rg9mtd1-001]

 
Come back to gene ENSMUSG00000044763


For any suggestions or comments, please send an email to unitrap@crg.es