Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14384G6
Clone ID IST14384G6
Vector VICTR74
Project tigm

Sequence tag IST14384G6HMR1
Sequence
ATANTGATTTGCTTTCNCTTTGGCCNGCTTACCTCCCGGTGGTGGGTCGNTGNNCATTCCGTAAGAAAAGCAGTTTTCAT
TTATGTCCTCTTTGACCGCTCCAGCTGTTCCTGGCGGGGAAGTTGCTTTCANATCTAATCCATATGCCTGGTCCACACCC
TTCCTTCCTTTCTCTGCTCTGGAAGCCTGTGTGCGATTGCTCGTGGCTTCCCTGATGCTGTCGTGTTTGTGGCTGN
Sequence Type genomic DNA
Unitrap ID UNI26449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102943049..102943229 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]


Sequence tag IST14384G6BBF1
Sequence
TTANAACTTAAAATACTTTTATAAGATTTTGTTTTCATTATTTTTATTTTTATTTACTTATTTATTTATTTATTTTTGGT
TTTTCGAGACAGGGTTTCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102942900..102942993 94
NO GENE  

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es