Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11189H4
Clone ID IST11189H4
Vector VICTR76
Project tigm

Sequence tag IST11189H4HMR1
Sequence
TCTGNCTGCCTCTGCTTCCCAAATGCTGGGATTAAAAGCATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11189H4BBF1
Sequence
NGAACCNAACTTACATTTGTCCCCCACCTGCCTCATACATAAAGCCAATACCATGTTAAAGGCAGGGAGTACCAACCCAG
GCCACCAGCCCTGAGCTTANAAAGGGGTTTGGCTATAACTAANAAAACTTTATGAATGTGAGCAACAATGTACTCACATA
CATAAAATAAATGTCTTTTAAAAAATATATTTATTTATGTATATATTATTCTATGTANNTACACTGTANCTGTCTTCAAA
CACACCANAANANGGCATNANATCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11189H4HMF2
Sequence
CAGCCTGGTCTACACAGTGAGTTCCAGGACAGCCAAGT
Sequence Type genomic DNA
Unitrap ID UNI34152 UNI34153 UNI34154 UNI35671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47864501..47864537 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025067 (D19Ertd652e) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D669]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6148223..6148259 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35780228..35780264 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12184572..12184608 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039458 (Mtmr12) NM_172958 myotubularin related protein 12 Gene [Source:MGI Symbol;Acc:MGI:2443034]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114517055..114517091 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37367926..37367962 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79261273..79261309 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 53041080..53041116 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 112346718..112346754 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140501493..140501529 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028927 (Padi2) NM_008812 peptidyl arginine deiminase, type II Gene [Source:MGI (curated);Acc:Padi2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 38962479..38962515 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152540903..152540939 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 87689006..87689042 37
NO GENE  

 
Come back to gene ENSMUSG00000028927


For any suggestions or comments, please send an email to unitrap@crg.es