Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14510F8
Clone ID IST14510F8
Vector VICTR74
Project tigm

Sequence tag IST14510F8HMF1
Sequence
CAACAAAAACAGAAACAATAGAAAGCTTACAGACTTACAGAAACTGAACAACTCTCTACAAAATGAAATACAGGTCAAAT
CAGAAATAAAGAAATTCAAGAATTCCAAAATTCAACAAAAGGAATATACATCATACTCAAACTTATATGACACAATGAAA
ACACTGCTAAGAGGAAAGTTCATAACACTAAGTGTCTACATCTAAAAGAAAAAAAATAGGGAGNTCTCATACTAGCAACT
TCACAGCACATCTGAAACTCTAGAACAAAAAGAAGCAAACACACACAAAAGGAGTGGACTGCATGAAATAGTAAAATTGA
GGGCTATAAAATAGAAACAAAGAATACAAAGAATCAATGAACAAAATTTTGTTTCTTTGAGAAAAATAAGACAGACAAAC
CCTTACCCAAACTTAAAAATGGANACAGAATATCCAAACTAACAAATTAAAACTGAAAACGTGTGATGGCNNTTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54052004..54052473 466
 
EST/CDNA Est Name
  CN666864.1


Sequence tag IST14510F8BBF1
Sequence
CAACAAAAACAGAAACAATAGAAAGCTTACAGACTTACAGAAACTGAACAACTCTCTACAAAATGAAATACAGGTCAAAT
CAGAAATAAAGAAATTCAAGAATTCCAAAATTCAACAAAAGGAATATACATCATACTCAAACTTATATGACACAATGAAA
ACACTGCTAAGAGGAAAGTTCATAACACTAAGTGTCTACATCTAAAAGAAAAAAAATAGGGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54052247..54052473 227
NO GENE  


Sequence tag IST14510F8HMR1
Sequence
GTTGTTGATACCTGGCTTTAATCCATGGTTGTCTGGTAGGATGGAGGGAGTTATTTCAATTTTCTTGTATCTCTTGAGAT
TTGCTTTGTACCTGAGTATGTGGAGAGTTTTGGAGAAAGTTCATGAGGTGTTGAGAATAATTTATATTCTTGTTTATATT
CTTGTTTATATTCTGTTTGGGTGGAATGTTCNGAANNTNTTTN
Sequence Type genomic DNA
Unitrap ID UNI22936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 54052470..54052671 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024976 (Shoc2) NM_019658 soc-2 (suppressor of clear) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927197]

 
Come back to gene ENSMUSG00000024976


For any suggestions or comments, please send an email to unitrap@crg.es