Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14937B10
Clone ID IST14937B10
Vector VICTR76
Project tigm

Sequence tag IST14937B10HMF1
Sequence
ATAGTAATTGCCCGAATAATGAACCAAACTTTTTTAGAAAACATGTATGTGATGATACAAAGGTAATGGTAATTTTTACT
TTACTATGAGCTTGGTTTTATATACAATTGTGTTAGAGAATTAATTCCATAATCTTTTTATACTAATGACAGGATTATCA
TTTGCCTATTATATTGTACTGTTGTCTATTATATGTTAATTTTACAGACACCCNGTCTCCAGGAGATACNNNTTACATAA
TAATTTGTTGTCCTTATTNCNTGTTGTNNAN
Sequence Type genomic DNA
Unitrap ID UNI32113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7576969..7577235 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040329 (Il7) NP_032397 interleukin 7 Gene [Source:MGI Symbol;Acc:MGI:96561]


Sequence tag IST14937B10HMR1
Sequence
CTACACAGANAAACCCTGTCTCCNAAAACGAAAAGCGNTTTCTTTAAAGTTCTTTGGCCGTTCCACCTCGCTCTTTCTGT
ATTCAAATAGCCCTCCTTTACTTTATAACTATTTGCTTTTTGTTTTGGGGAACTCCGCCCTCATTTCTGTTAAGTCCTCA
TTGAAAAGACAAGGAAGCTGTCAGGCATCCAGGAGGCGTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134656936..134657138 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es