Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14435A9
Clone ID IST14435A9
Vector VICTR74
Project tigm

Sequence tag IST14435A9HMF1
Sequence
CTATCTGTAGCGTATGCTCACGTATCCTGTCCTCAGAGAACTCGGAAGTCAGAGGAGGGCACTGGGTAACCTCCACTCTC
TCTCTCCACCTCAGTCCTTTGGGACAGAATCTCTAAATGAAAAACACACAGCTTGTGGTTTTGAGGCTAGGCGAGCCCAA
GAGCACCTCCCGTCCCCGCCCACTGGAGTGTTGGGATTACAGGCATGCGTANAACCNAGGCCAGCTTTACAATGGGGTGC
AAGGATTTCATGCTTGGAAAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123371990..123372251 258
 
EST/CDNA Est Name
  AV086717.1 - CF161925.1 - CF898432.1


Sequence tag IST14435A9HMR1
Sequence
ATAGNAAGTGTGTGTGTGAGAGAGAGAGAGAGTCTGTGATACTCCGGACAAGTGTTTGGTGTCACTTTGGGTACAAGATG
GTACGTGCCTGGTAAATTCAGGGCAATGTGCTACATGCCTGGATCTCTGTAGGTTCTAGGCAAGCCAGAGCTAAAAAATG
AAATCGGGTCTCAAAACATTTTTGGGAAGCGGGATGGATGTTGTATGTTGTAATGTTGTAAGTCCATAGGAATTCTAGGT
GACATAGTTGGGCGGGNNTTN
Sequence Type genomic DNA
Unitrap ID UNI11698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123371738..123371993 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es