Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10364C7
Clone ID IST10364C7
Vector VICTR76
Project tigm

Sequence tag IST10364C7BBF1
Sequence
GTGGTTTGGGTGGACACCTTTTCCTCCTAANACCTTGATTGCAAGGACTTCTGACTAGTGCCATATCAGAGGCCTTAATC
TGTAAGAATGCGAGCGAGCAGTGCGCCCAGCTGAGGATCTGGACCCGCTGAATCCAAGGGCTTGGAAGGTTAACGCGCAA
ACGTGCAGAGCCACGGTTAAAACGCTTTCAGCATCCCTGCGCTATTATTGCACCGTTTAAAAACCTCCGACAGATTTCAA
TTCGTTAAACTAGTTCTCCATCCGTTACTCTAAACTCCTCCCGGACCGGATGGTTNAGCAGCGGCGCCCCGGCGTCCAGA
CNACGCGTCACCGCCCCCCATGGACGCCCCGAGACGCGCAAATTGAGCGCTGTGTCTTNNANNGGGAATCGGCCTTTTCC
GTCCANGANAAAATGTNTGCGANGAGCCCGGANGCGANGGGCGACCATCGCGGCGTCCGGGTGAGCGTGGCTGGCTGGGG
CTCGGTGGCGTGGCNTGNNNTGNCNNNAGCNANCGN
Sequence Type genomic DNA
Unitrap ID UNI14715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96094840..96095336 469
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041995 (Zbed3) NM_028106 zinc finger, BED domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1919364]


Sequence tag IST10364C7HMF1
Sequence
GTGGTTTGGGTGGACACCTTTTCCTCCTAANACCTTGATTGCAAGGACTTCTGACTAGTGCCATATCAGAGGCCTTAATC
TGTAAGAATGCGAGCGAGCAGTGCGCCCAGCTGAGGATCTGGACCCGCTGAATCCAAGGGCTTGGAAGGTTAACGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96094840..96094995 154
NO GENE  

 
Come back to gene ENSMUSG00000041995


For any suggestions or comments, please send an email to unitrap@crg.es