Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14535D11
Clone ID IST14535D11
Vector VICTR74
Project tigm

Sequence tag IST14535D11BBF1
Sequence
CTTTATGTCTATCGAAAGACTGAAACCTTGTAATAAAGTAAATTGTCATAGCAGACAAGTCTGTTCAAGGCATTATGGAA
ATTTTCATATAGCACCAATACCAAAAGCAAGTCCAGTGCTGACTTACTACAGGGCCTGAGGTAATCCCACATGGAAAGAA
TGCTGCAATCTGTTATAAAGAGGTCAAGAACACAGCTATACTGTAGGAAGAAGACTTGGCATAAGGGCAAACAAAATTCC
AGGCATTGAAACTTTGATTCTGGTAGAGCTTACAATCCACTCATTTTTTTTCCAGTCTAAGTTTCCCTGATTTACNAGTG
GCTTTTTCTGAGTTTGCTTTTGTGGCTGGTCTTGAACTCCTAANCCNAGTGCTAGGATTATAGGGACACACTATTACNCC
CATCATACCTTATCNNGACANATCNNNANNGGGGGANANCNNANAATGATCAGNNGANANTTTTANTTNNCTTNTCNCCC
TCANNANANTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14535D11HMR1
Sequence
AAAGGAATTACAGTTAGTNATTANAATCAATTTGGGAATTTTAAAAAAAACCAGTTTTGTTATGTCTGAAAAATCAAGTT
ACTCCTTAGTTGAGGAATCTTCAATGACAGGATCATTGTTAGTTATAACTACAATCAGATAGTTGATTCTCACAGTAACT
TTGTCATGGTTGGTATCAGTTATCTCCATTGTACAGATGAAGATGTACAGATGAAGCATAN
Sequence Type genomic DNA
Unitrap ID UNI6916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154715108..154715327 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es