Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST465431
Clone ID OST465431
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST465431
Sequence
TGAGGTCTGCTTGGACTTTGGAAACGGNCTTCACTTAGAGGTCTTCAGCCCAAGAAATGAAGGCAAACCGTTCCCTAAGC
ACACTCACTTGGTTCGTCAAAAGAGGGCCTGGATCACTGCCCCTGTGGCTCTGCGGGAGGGCGAAGACCTGTCCAGAAAG
AACCCGATTGCCAAGGTAGCAGCTACAGAAGAATGTGGCGAGGGTGTTGGCGGGGTGGCTAAGGCTGTGGCAAATAAAAA
TTATTAGGTCCACTTTCCAAAATAAAGAGAATCAGGTGATGTACATAAAA
Sequence Type mRNA
Unitrap ID UNI16186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20731988..20733690 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044393 (Dsg2) NM_007883 desmoglein 2 Gene [Source:MGI (curated);Acc:Dsg2-001]

 
Come back to gene ENSMUSG00000044393


For any suggestions or comments, please send an email to unitrap@crg.es