Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12237H3
Clone ID IST12237H3
Vector VICTR76
Project tigm

Sequence tag IST12237H3HMF2
Sequence
TTTTTNNTATATTATGCATTTTAATTAAGATTTAATTACACCAAAAGAATTTAGACTGACCAATTCAGAGTCTGCTATTT
A
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12237H3BBF1
Sequence
TTTTTNATATATTATGCATTTTAATTAAGATTTAATTACACCAAAAGAATTTAGACTGACCAATTCAGAGTCTGCTATTT
ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGN
NACA
Sequence Type genomic DNA
Unitrap ID UNI8171

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32584928..32585044 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35249084..35249200 111
NO GENE  

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es