Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14380A3
Clone ID IST14380A3
Vector VICTR74
Project tigm

Sequence tag IST14380A3HMR1
Sequence
TANTGTTTTTANTTTAAATTTGGGCCCNNNNCNNTCATTTANCCNNANCCACTTGAACAAAGANAANTCNCNGGATTACA
ATACCATTTGTTGCAAAGAGAAACATTTTGTCTATGGGCATAAGCACAGATATTTCAAAGGCGTGTCAATTTAGTTAAAC
AACAGTAATAAGGTATCATTTTGAGTCATATTCCCAAACATAGGTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14380A3BBF1
Sequence
TTAGGCAGGGTGACGGGAAAGGACCTGGAGGTGAACGAGAACCAAGGCCTCTGATCGGTTCCCCCCCCCCCCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91549972..91550044 73
NO GENE  


Sequence tag IST14380A3HMF2
Sequence
AGGGCTCTGTCTCAGTGAGTGGACTCTTGGGAAAACTACCAAGCCCTCCCAGCCCCTCCTAGCTCCTGCCCCAACCCAAT
CTCCTCCTTCAACATTCCGGCCCAGGGTGCAGCTAGGGCTCCCCCGGGTGCAGGCTCACTGTGTGCTGAAGTGGGAAATC
CCCTCTCTGCCTTCTCCAGTCTTGTTGGAGCCCAGGTTCTAGGCAGGTGGGTTCCATTATGTCCAGCCATCGTCCTCTGT
CTTCTCGCTCCAAGCTGGGAGCTCCTAGCCTGGGAGGGCGTGTGTGTATGACAGAAACCCAGAATTGCCTGGTGCCCTGT
CCTCTGCCTCCCCTTACCCTCCAACCTAGACTAAGTGCTTCAGCATTGTGCTGCTGGGTTAGTGTGTCTCCTGCTCNCTG
TCTTTCCTGNANTGTTCCCTCCGTGNAGGGAACCNAGGATTGTGTTNCCC
Sequence Type genomic DNA
Unitrap ID UNI679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138072013..138072460 435
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es