Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0138
Clone ID AZ0138
Vector pGT0lxr
Project sanger

Sequence tag AZ0138
Sequence
GTAGCAGTAGGTTGGCGTGTACTGTTCAGACTTAGTTATTAGGCTAAAATCAAATAGTCTCCTTTGGTATGTGCACTTTC
CCGCTGGCGTATCCTCGCTATGCCTCCCCGACTGCAGCCGGCGCTGGTGACGCGCGCGACCGAGCCCGGGGCCTGTCGCT
GCCGCCGCCGCCGCCGCCGCCGCCGCCAGGTGGTGACTGGACTCTAGACCATGTGCCTAGGTAGTTTTTCCGTTCTCCGC
AGCTCTGCTTCCCCAGCAACGCTCACCACACCCTTGTTTTGAGAACCTCACTAAGTACTTGTCAGCATCCAGCCATGGGG
GATATGAAAACTCCAGATTGGGATGATCTCCTGGCTGCCTTTGACATCCCAGATCCCACAATGTCTTGATGCGAAGGAAA
CCATACATCATTCCTTATAGGTGCAGGAGATTCCCCGCACTTCTCACGCACGTGTCTTCATGATAACAGGTCTCAGTAGC
AATTGCCCTCTGTCCTACATGTCACACAG
Sequence Type mRNA
Unitrap ID UNI3019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88138579..88168363 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005621 (Zfp592) NM_178707 zinc finger protein 592 Gene [Source:MGI (curated);Acc:Zfp592-001]

 
Come back to gene ENSMUSG00000005621


For any suggestions or comments, please send an email to unitrap@crg.es