Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13119D7
Clone ID IST13119D7
Vector VICTR76
Project tigm

Sequence tag IST13119D7BBF1
Sequence
TTTAGTTTGTGGTCTGCCTGAGTCAAGTTCAAGGCAAGTTTGAGACAGTAAGACCCTGTCTTGCCACCACCAACAACAAT
AACAAAAAAAGAAAAAGAAAAGAAAAGAAAAGAAGAGAAAGAAAGAAAGAGAAAAAGAAAAAGAAAGAAGGCAAGGTTCA
TTGTTTTTCCATCCTGAGACAGGGTTTCTCTGTGTANCCCTGGTGGATCTGGAACTCAAGTTGTGGATCAGGCTGGCCTC
AGGCTGGCCTCGAACTCACAGAGATCCACTTGGTGGTGGAAGGCATAGGTCATATACCTAGGCGAGGAACTGGAAGCTCA
CAGCATCNTGATGGAACTCTCCNTCTCCTCTCTCNNGGATTGTGAGAGCCNTGNNGAGCGAGCGACACNTANCCTGCTCC
AGGATCN
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87335059..87335463 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]


Sequence tag IST13119D7HMF1
Sequence
GTTAGTTTGTGGTCTGCCTGAGTCAAGTTCAAGGCAAGTTTGAGACAGTAAGACCCTGTCTTGCCACCACCAACAACAAT
AACAAAAAAAGAAAAAGAAAAGAAAAGAAAAGAAGAGAAAGAAAGAAAGAGAAAAAGAAAAAGAAAGAAGGCAAGGTTCA
TTGTTTTTCCATCCTGAGACAGGGTTTCTCTGTGTAGCCCTGGTGGATCTGGAACTCAAGTTGTGGATCAGGCTGGCCTC
AGGCTGGCCTCGAACTCACAGAGATCCACTTGGTGGTGGAAGGCATAGGTCATATACCTAGGCGAGGAACTGGAAGCTCA
CAGCATCGTGATGGAACTCTCCATCTCCTCTCTCAAGGATTGTGAGAGCCGTGGGGAGCGAGCGACACATAGCCTGCTCC
AGGATCCTCCCGCTGANTCCAAGCCCCAGANATCCTGATATGCCACATTCACAGGGCTCTATCTGGCAATANGATCCCTG
GGATTTTTCTAGTCTTGNCNGAGGGACCCAGCNNAGCTCGAGNNTTANAACNTCTCCCTATGANTGANCTGATNGCACTT
CTTTAGNANGGCAAGN
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87335058..87335632 543
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es