Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11826C2
Clone ID IST11826C2
Vector VICTR76
Project tigm

Sequence tag IST11826C2HMF1
Sequence
CCCAAAACATAGAAGAGAATACCAGGAGAAAGGGGAATGGCACCTGAGAAAAGACACACTCATTTAAAACCATGCAGAAC
TACATGGAGAGCCTGCCACTTTATATTTCTTAGAAACAGGTGAGTGATGACTGTTTTGCAACTCAGTAGCAGTTCACCAG
ATCTTCAGGACTAAGACAAAATCAAGTAGTTAAAAATACTGCTTATGACCATTTCTTCCTTAATTTTTTAGAAGTCACGG
ATTCTATGGAGGTACCTTCTAAAGTACTACTTCAGTTGTGATGTTTCTATTGAAAAACATGTGCCTCTCCCTCCTATGAG
GGAGACCAAAATTAGCACCATGCCATCCACATCTGACAAGCAGTAACAGCTGANGAACTCTGCTACTTACCACACACAAT
CCTCAATTTATGATTTCTCACTTTTATGATGGCATGAAAACNATTCCNCTCCTTGTCTCTTCAGTAGATCGCTCAATAAA
TCNCAGAAGANATTTAATATTTTATTATAAACTTTTGN
Sequence Type genomic DNA
Unitrap ID UNI33280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17583489..17584005 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]


Sequence tag IST11826C2BBF1
Sequence
CCCAAAACATAGAAGAGAATACCAGGAGAAAGGGGAATGGCACCTGAGAAAAGACACACTCATTTAAAACCATGCAGAAC
TACATGGAGAGCCTGCCACTTTATATTTCTTAGAAACAGGTGAGTGATGACTGTTTTGCAACTCAGTAGCAGTTCACCAG
ATCTG
Sequence Type genomic DNA
Unitrap ID UNI33280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17583489..17583652 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]

 
Come back to gene ENSMUSG00000047786


For any suggestions or comments, please send an email to unitrap@crg.es