Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13606G4
Clone ID IST13606G4
Vector VICTR74
Project tigm

Sequence tag IST13606G4HMF1
Sequence
GATTGCTCTGCGCAGGGCCTGGGGCTCGCCCCAGTCTCAGGGAGCCGGTCTTACCTCCACCTCCTGCGCTCCTTTCTTCC
TTCCCTGCGGCCGGGCGATCGCGGACAGTGGTGGCGGANAGGGAGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4947552..4947678 125
 
EST/CDNA Est Name
  AK003337.1 - NM_026741.2


Sequence tag IST13606G4HMR1
Sequence
TCTGCAAGGCCTCGACCCGCTGCCTTAGTTCTGCAGATCACACCTACCCGGAACAGATAGACCCCCTCTTGGACCTAGAT
CCCCCGACAGCCGGCAGGTTCCACGCCCTCCCCCGACACCACGCCCGGCCAGGGGTC
Sequence Type genomic DNA
Unitrap ID UNI35680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4947417..4947553 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051550 (Zfp579) NM_026741 zinc finger protein 579 Gene [Source:MGI Symbol;Acc:MGI:1915740]

 
Come back to gene ENSMUSG00000051550


For any suggestions or comments, please send an email to unitrap@crg.es