Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14180F4
Clone ID IST14180F4
Vector VICTR74
Project tigm

Sequence tag IST14180F4HMF1
Sequence
TTGGAGCTCTGCGGCCGACCTAGCGCGTGCCGGACCCAACCGCCACCTTCGACCAGAGAACTAGGGAAGCGGACCGCAGC
TAAGCCCCGAGCTAGGCCTGACCAAGAACGGCAAACGCTCTCCACAGACCCAATCTACAACCGGCCCAGACCAGGAACAC
CTTAAGCCCCAGACCTAGACACAAGACTACAGCCTAGACTGGAACCCGTTCGGCCTTGTGAGCAGTACCGGCCCCACTGT
CC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062768..30063007 240
 
EST/CDNA Est Name
  BX633822.1 - AA064418.1


Sequence tag IST14180F4HMR1
Sequence
NNGGAGTAGGCAAGGCTGGTGTCACCCAGTCCTGGCGTCCTCACTGCATTCTGCAAGCAAGGGGTCAGGTGGCCTGCGAA
GAGCAGGACTCCCATGGAAGGCNCAATCACCGGCCCAGGCCTCCAGGCAGCGAAGGGGGCCGGGTGGGAAGGCCAAGGCG
GTTTCCAGGGACTGTTGGGAAGTTTGCTANGCGACCCGCCTGGCTCANCTTACTTTTAAAACTAGTTTGATGTTGGCCTC
GAAGGTTGCTTTGCTGTGGTTTACGTAACAAAGTTTATGTAACTGGANTTTACNCTANGTCTTAATTTACTTCGGTTGTG
TTC
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30063008..30063327 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es